Multiplexed in situ Hybridization Workshop Forum

Open forum between instructors and trainees of the "Multiplexed in situ Hybridization Workshop" that was held on March 22, 2017.

Please post questions and/or share thoughts from the workshop.

Lead Instructors/Contact:


Workshop Materials and Recordings for reference

 

 


 

I am wondering what sequences/ Accession #s were used for SftPC as there is multiple variants listed. Or advise in choosing variants as several come with references.
Thanks
Jason

By jgokey --

Jason Gokey

hi Jason,
I'll ask Monica to post this info on the board. I think she may not yet have logged in.
thanks,
Tushar

By tdesai

Hi Jason,

The NCBI Reference Sequences we used for SFTPC (mouse): NM_011359.2; SFTPC (human): NM_003018.3.

Probe sequences : (mouse) works in Cy5
mm-HL5X-Sftpc-646 TAGCGCTAACAACTTACGTCGTTATGTGCGGTTTCTACCGACC
mm-HR5X-Sftpc-663 GGTCTTTCCTGTCCCGCTTATACGTCGAGTTGAACGTCGTAACA

Probe sequences : (human) works in A488.

humHL2X-SpC-627 TCGTACGTCTAACTTACGTCGTTATGTGGCCCAGCTTAGACGTAGG
humHR2X-SpC-627 CTGCATCTCGCCCCTCTGCCTTATACGTCGAGTTGAAGAACAACCTG
humHL2X-SpC-71 TCGTACGTCTAACTTACGTCGTTATGAGGGAGAGGGGACAGAGGTG
humHR2X-SpC-71 AGGGTCTTATATGTGTCCGTTTATACGTCGAGTTGAAGAACAACCTG
humHL2X-SpC-348 TCGTACGTCTAACTTACGTCGTTATGTCCAGAACCATCTCCGTGTG
humHR2X-SpC-348 CCGGCGCCCCAATGCTCATCTTATACGTCGAGTTGAAGAACAACCTG
humHL2X-SpC-250 TCGTACGTCTAACTTACGTCGTTATGAAGAAGGCGTTTCAGGTGCA
humHR2X-SpC-250 ACCACCACCACCACCACGATTTATACGTCGAGTTGAAGAACAACCTG
humHL2X-SpC-118 TCGTACGTCTAACTTACGTCGTTATGTCCTCTCCTCCTCTCCCAGG
humHR2X-SpC-118 TTGCTGCAGGTGCTATGCTCTTATACGTCGAGTTGAAGAACAACCTG
humHL2X-SpC-543 TCGTACGTCTAACTTACGTCGTTATGTCAAGACTGGGGATGCTCTC
humHR2X-SpC-543 GGACTTTTCTAGTGAGAGCCTTATACGTCGAGTTGAAGAACAACCTG
humHL2X-SpC-480 TCGTACGTCTAACTTACGTCGTTATGTTGTAGGCGATCAGCAGCTG
humHR2X-SpC-480 AGCAGGTGCCAGGGGCTGGCTTATACGTCGAGTTGAAGAACAACCTG
humHL2X-SpC-762 TCGTACGTCTAACTTACGTCGTTATGTTCCACTGACCCTGCTCACC
humHR2X-SpC-762 GTTTCCTTTCCCGTTGGGGCTTATACGTCGAGTTGAAGAACAACCTG

Best,
Monica

By nmonica

Hi everyone,
Thanks for participating in the workshop. Please add questions and comments liberally and we will do our best to check the board and reply weekly.
Remember, for best results, especially in the beginning, try to target highly expressed genes as these are the easiest. For your sanity, it might be best to also select and obtain > 10 probe pairs from the get-go for genes that are not highly expressed, then test them in batches of 5, for instance. This way, you can hopefully identify a pool that gives good signal in a streamlined way, rather than ordering 5 pairs, finding they don't give strong signal, then having to go through the entire processn (and delay) to obtain another 5 for testing.
We'd love to hear your feedback, in particular for applications and species we haven't yet attempted, so please post briefly your experience for us and others.
thanks a lot,
Tushar

By tdesai

Dear All,
I am going to order label probes. Please what type of probes I should select on the IDTDNA website? For example, should I go in "Custom RNA Oligo", then write the sequence (5'--3' direction) and select the type of labeling to add at the 5'?
In addition, I cannot find in the list the Y1-A488 label.
Many thanks in advance.
Best,
Gianni

Hi Gianni,
You have to choose Custom DNA oligos (not RNA),
Scale- 100nmole DNA oligo,
Sequence- Choose 5'Mod (it gives you a list of flurophore options), pick -/5Alexa488N/
You can then paste your seq and order.
Best,
Monica

By nmonica

Thank you Monica. So for the 4 probes you suggested on IDT I will pick 5Alexa488N, /5Cy3/, /5Cy5/, /5TexRd-XN/ and I will also add HPLC (but no need to be RNAse free) purification, is everything correct? Also, is /5TEX615/ could be an option for the Texas red above?
Thank you,
Gianni

We use /5TEX615. This is an alternative for Texas red NHS ester. We have not tried the ester.
Best,
Monica

By nmonica

Hi Gianni,
If you are working with early stage embryos (<24hpf), you can try the ISH in two batches with and without AR. Beyond 24hpf, I think AR is necessary. RNAscope based ISH methods use a commercial reagent with protease for doing ISH in embryos (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4172952/). They don't have any information on the concentration. If using protease, the treatment has to be mild. Also ensure there isn't overcrowding of embryos/tube so that they are not damaged during washes. Once you have the AR optimised with probes that detect highly expressed transcript, you can test other genes of interest.
Best,
Monica

By nmonica

Hi Monica, thank you for your reply.
I want to detect gene expression in the whole embryo. To do this I would need probes that detect mRNA, therefore they should be RNA probes. In the protocol you provided at the course I cannot find any step requiring RNA polymerase. So, how can I detect gene expression? Is that protocol only for DNA in situ hybridization?
Thank you.
Best,
Gianni

Hi Giannni,
The protocol is for detecting mRNAs. The H probes are ordered from IDT as DNA oligos that have regions that bind to the endogenous mRNA resulting in a RNA-DNA hybrid. The circles and bridges are also DNA oligos. The images that we showed in the workshop were obtained by doing PLISH to detect mRNAs in cell lines and mouse. I hope this answers your question.
Best,
Monica

By nmonica

Dear All,
Label probes binds to the CC, please correct if I am wrong. However, label probes, for example the DP5-Cy5, corresponds to the middle sequence of CC05-DP5 (that works with Cy5). Should not these sequences be complementary?
Thank you.

Hi Gianni,
Rolling circle amplification results in amplicons that are complementary to the the circle (in your case complementary to the CC05-Cy5 and bridge sequences). The detection oligo DP5-Cy5 binds to these RCA amplicons. The DP5-Cy5 sequence corresponds to a part of the CC05-DP5 sequence and complementary to the RCA amplicons.
Best,
Monica

By nmonica

For future use, how should we reference the method?
by the way it is working great on our end

By jgokey --

Jason Gokey

Hi Jason,
Good to know that the protocol is working well for you. Please email and check with us whenever you are planning to submit your work. We can let you know about the status of our paper.

By nmonica

Hi Monica,

I did the ISH in the whole zebrafish embryo, but it did not work for me so far. I do not know yet if the problem is the probe or the permeabilization of the embryo. Is there any technique I can use to check that probes are ok, so that i can focus on the permeabilization improvement?
Thank you.
Best,
Gianni

Hi Gianni,
Sorry for the late reply. Can you give me some information about the genes that you tested- are these housekeeping or highly expressed genes, stage of embryo . If it is housekeeping you should be able to see signal even on the skin which I don't think needs too much permeablisation. If you can tell more about your experiment , I can give a suggestions accordingly.
Best,
Monica

By nmonica

Add new comment

Plain text

  • Allowed HTML tags: <a> <em> <strong> <cite> <blockquote> <code> <ul> <ol> <li> <dl> <dt> <dd>
  • Web page addresses and e-mail addresses turn into links automatically.
  • Lines and paragraphs break automatically.

Copyright ©2013 NHLBI Progenitor Cell Biology Consortium.

University of Maryland School of Medicine logo

National Heart Blood and Lung Institute logo